Παρασκευή, 21 Οκτωβρίου 2016

ΑΣΚΗΣΗ ΜΕ ΤΟ ΠΛΑΣΜΙΔΙΟ Ti



Θέλουμε να κατασκευάσουμε ένα  διαγονιδιακό φυτό ποικιλίας Bt  στο εργαστήριο .Για το σκοπό αυτό χρησιμοποιούμε το πλασμίδιο Ti που το απομoνώσαμε από το βακτήριο Agrobacterium tumefaciens .Στο πλασμίδιο αυτό υπάρχουν οι εξείς περιοχές :
α) η περιοχή ori που είναι υπεύθυνη για την αντιγραφή του πλασμιδίου ,
β) η περιοχή con που είναι υπεύθυνη για τη συζευκτική μεταφορά του πλασμιδίου στο βακτήριο ,
γ) η περιοχή T DNA  που περιέχει γονίδια που δημιουργούν όγκους ,όπως γονίδια που κωδικοποιούν τις φυτοορμόνες Αυξίνη και Κυτοκίνη  αλλά και περιοχές που συμβάλλουν στην ενσωμάτωση  του TDNA στο DNA των φυτικών κυττάρων ,
δ) η περιοχή vir που είναι υπεύθυνη για τη μεταφορά του T DNA μέσα στο φυτικό κύτταρο .
1) Αν διαθέτουμε περιοριστικές ενδονουκλεάσες που μπορούν να δράσουν σε όλες τις παραπάνω περιοχές , ποια περιοχή θα θέλαμε να κόψουν και για ποιον λόγο ;

2)  Στην περιοχή που κόψαμε ενσωματώνουμε το γονίδιο μιας  εντομοτοξίνης  , το οποίο το απομονώνουμε από  ένα βακτήριο με την βοήθεια της περιοριστικής ενδονουκλεάσης Taq I  , που αναγνωρίζει την
TCGA  3΄
AGCT  

αλληλουχία            και την κόβει μεταξύ Τ και C .

Με ποια περιοριστική ενδονουκλεάση θα πρέπει να κόψουμε το πλασμίδιο Τi ; Αιτιολογείστε την απάντησή σας .

3) Γιατί η ποικιλία ονομάζεται Bt ; Να περιγράψετε αναλυτικά τον βιοτεχνολογικό τρόπο δημιουργίας της και να αναφερθείτε και στα ένζυμα που θα πρέπει να χρησιμοποιηθούν .

4) Αν το γονίδιο της εντομοτοξίνης βρίσκεται στο παρακάτω τμήμα DNA , να αποδώσετε το θραύσμα που περιέχει το γονίδιο , μετά τη δράση της Taq I .Ο υποκινητής του γονιδίου , σε ποια μεριά του θραύσματος (αριστερή ή δεξιά) , μέσα στο ανασυνδιασμένο πλασμίδιο Ti θα βρίσκεται ;

CAAGCTCCTTACTCGACATGCCTTACGACAAGTTC TAAGATTCTTTAGCTCTCGACG  
GTTCGAGGAATGAGCTGTACGGAATGCTGTTCAAGATTCTAAGAAATCGAGAGCTGC

5) Με τη χρήση του γενετικού κώδικα να βρεθεί το πεπτίδιο της εντομοτοξίνης  .

Δεν υπάρχουν σχόλια: