Τετάρτη, 12 Φεβρουαρίου 2014

ΑΣΚΗΣΗ ΜΕ ΠΟΛΥΣΩΜΑ





















Δίνεται  ένα τμήμα  mRNA πολυσώματος  , που είναι υπεύθυνο για τη σύνθεση του τελευταίου τμήματος  της Ινσουλίνης :

AAAAAAUGCAAUCAAUGUUAUCAAAAGAUUAAC…5΄

Αν το τελευταίο tRNA που προσδένεται στο mRNA είναι το  3΄…UUG…5΄   να απαντήσετε στα παρακάτω ερωτήματα :
α) Ποιο είναι το τμήμα του πεπτιδίου που κωδικοποιείται από το κομμάτι  αυτό του mRNA που αναφέρεται  παραπάνω ; Να επισημάνετε και τον προσανατολισμό του τμήματος αυτού του πεπτιδίου .
β) Όταν αποδεσμεύεται  το tRNA που μεταφέρει  το  τέταρτο από το τέλος αμινοξύ  , το tRNA  που έρχεται  , πιο αμινοξύ κουβαλάει και ποιο είναι το αντικωδικόνιό του ;
γ) Στο πολύσωμα το τμήμα του mRNA που μεταφράζεται είναι 333 ριβονουκλεοτίδια . Ποιο είναι το μήκος του προϊόντος  που παράγεται από το πολύσωμα ;
δ) Στο κωδικόνιο της Κυστεΐνης (Cys) που περιέχεται  στο παραπάνω mRNA  γίνεται αντικατάσταση  της μιας U σε C . Τι πιθανές  επιπτώσεις θα έχει αυτό στη δομή και στη λειτουργικότητα της Ινσουλίνης ; Να λάβετε υπόψη σας ότι οι Κυστεΐνες περιέχουν Θείο (S) .
ε) Αν γνωρίζετε ότι το μήκος που καταλαμβάνει το ριβόσωμα στο mRNA είναι κατά 3 βάσεις μεγαλύτερο από το μήκος των αντικωδικονίων που μπορεί να δεχθεί και ότι η απόσταση μεταξύ δύο διαδοχικών ριβοσωμάτων είναι 60 βάσεις να υπολογίσετε τον μέγιστο αριθμό των ριβοσωμάτων του πολυσώματος .

Δεν υπάρχουν σχόλια: