Κυριακή, 9 Οκτωβρίου 2016

ΑΣΚΗΣΗ ΜΕ ΑΝΑΣΥΝΔΙΑΣΜΕΝΟ ΠΛΑΣΜΙΔΙΟ

Το παρακάτω τμήμα DNA ενός βακτηριακού κυττάρου , περιέχει γονίδιο που κωδικοποιεί ένα ολιγοπεπτίδιο , το οποίο θέλουμε να το παράγουμε μαζικά , με βιοτεχνολογικές μεθόδους .

5΄ ACGAATTCACTGGATCCCGTTACCGTCGAGGCATCACGAATTCACATGGATCCAG 3΄
3΄ TGCTTAAGTGACCTAGGGCAATGGCAGCTCCGTAGTGCTTAAGTGTACCTAGGTC 5΄

Για το σκοπό αυτό έχουμε στο εργαστήριο τρεις περιοριστικές ενδονουκλεάσες : την EcoRI , TaqI και τηνBamHI .
Η Taq I αναγνωρίζει την αλληλουχία 5' TCGA 3' και την κόβει μεταξύ Τ και C ,
                                                            3' AGCT 5'
ενώ η BamHIαναγνωρίζει την 5' GGATCC 3' και την κόβει μεταξύ G και G .
                                                 3' CCTAGG 5' Επίσης διαθέτουμε και το παρακάτω πλασμίδιο :


  
Στο σχήμα φαίνονται :
-       - οι περιοχές  του πλασμιδίου που  αναγνωρίζουν και κόβουν οι τρεις περιοριστικές ενδονουκλεάσες
-       - ο υποκινητής του γονιδίου ,   οποίος κωδικοποιεί το ολιγοπεπτίδιο
-        -τα δύο γονίδια που προσδίδουν ανθεκτικότητα στα αντιβιοτικά αμπικιλίνη και στρεπτομυκίνη
α) Ποια περιοριστική ενδονουκλεάση μπορεί να  χρησιμοποιηθεί για τη δημιουργία του ανασυνδιασμένου DNA ;Να αιτιολογήσετε την απάντησή σας .
β) Να περιγράψετε τον τρόπο με τον οποίο θα γίνει η επιλογή των μετασχηματισμένων βακτηρίων.
Ποιο είναι το ολιγοπεπτίδιο που θα παραχθεί στα μετασχηματισμένα βακτήρια (χρήση γενετικού κώδικα) ;
γ) Να αποτυπώσετε στο τετράδιό σας το θραύσμα που προκύπτει μετά τη δράση της κατάλληλης περιοριστικής ενδονουκλεάσης και το οποίο περιέχει το γονίδιο του ολιγοπεπτιδίου .Πόσοι δεσμοί έσπασαν  και ποιοι κατά την δράση της περιοριστικής ενδονουκλεάσης ;
δ) Να αποτυπώσετε στο τετράδιό σας το ανασυνδιασμένο πλασμίδιο και να φαίνονται σε αυτό οι αλληλουχίες του θραύσματος που ενσωματώθηκε .Πόσοι δεσμοί δημιουργούνται με τη δημιουργία του ανασυνδιασμένου DNA ;
ε) Σε ποια περίπτωση η ενσωμάτωση του θραύσματος , που περιέχει το γονίδιο του ολιγοπεπτιδίου , δεν επιτρέπει την έκφραση του γονιδίου αυτού ; Να αιτιολογήσετε την απάντησή σας .




Δεν υπάρχουν σχόλια: