Κυριακή, 2 Οκτωβρίου 2016

ΑΣΚΗΣΗ ΜΕ ΚΑΤΑΣΚΕΥΗ ΑΝΑΣΥΝΔΙΑΣΜΕΝΟΥ DNA



Το παρακάτω τμήμα DNA  περιέχει ένα γονίδιο που είναι υπεύθυνο για τη σύνθεση ενός  ολιγοπεπτίδιου .
CGAGCTCGGATCGTCTTAAGCTTGTACGTCAGCTAA 
GCTCGAGCCTAGCAGAATTCGAACATGCAGTCGATT
Για την απομόνωση του γονιδίου , έχουμε στην διάθεσή μας δύο περιοριστικές ενδονουκλεάσες , την
EcoRI και την TaqI  που αναγνωρίζει την αλληλουχία : TCGA  3΄
                                                                                                                  3΄ AGCT  

       και κόβει μεταξύ Τ και C .
Να απαντήσετε στις παρακάτω ερωτήσεις και να τις αιτιολογήσετε .
α) Ποια από τις δύο περιοριστικές ενδονουκλεάσες θα χρησιμοποιηθεί και πόσα θραύσματα θα δημιουργηθούν από το κόψιμο του τμήματος αυτού;
β) Να γράψετε το θραύσμα που περιέχει το γονίδιο που θέλουμε να κλωνοποιηθεί .
γ) Να σχεδιάσετε το ανασυνδιασμένο πλασμίδιο και στο σχήμα να φαίνεται το θραύσμα με το γονίδιο και τα σημεία ένωσής του με το κομμένο πλασμίδιο .
δ) Να γράψετε το μεταφραζόμενο τμήμα του γονιδίου , με τον προσανατολισμό του .
ε) Να βρείτε , με τη χρήση του γενετικού κώδικα , το πεπτίδιο που παράγεται .

Δεν υπάρχουν σχόλια: