Τρίτη, 4 Οκτωβρίου 2016

ΑΣΚΗΣΗ ΜΕ ΑΠΟΔΙΑΤΑΞΗ ΚΑΙ ΥΒΡΙΔΟΠΟΙΗΣΗ



Τα παρακάτω τμήματα DNA , περιέχουν γονίδια από δυο βακτηριακές αποικίες μιας cDNA βιβλιοθήκης. Προσπαθούμε να ανιχνεύσουμε με τη μέθοδο της υβριδοποίησης  , ποια αποικία έχει το επιθυμητό γονίδιο , που κωδικοποιεί ένα  φαρμακευτικό ολιγοπεπτίδιο .

GCGATGGGGCGCTGACCGATC GCCG  
CGCTACC C CGCGACTGGCTAGCGGC                            ΤΜΉΜΑ Α


 ΤΤAATGTTTATGTGAGGCTAGTAT AATAA 3 ΄
3΄ ΑΑTTACAAATACACTCCGATCATATT ATT                     ΤΜΉΜΑ Β


Για το σκοπό αυτό χρησιμοποιούμε ένα ιχνηθετημένο μόριο RNA : 3΄CCGAUC  .
Να απαντήσετε στις παρακάτω ερωτήσεις :
α)  Ποιο τμήμα θα αποδιαταχθεί γρηγορότερα και γιατί ;
β)  Ποιο τμήμα  έχει το επιθυμητό γονίδιο ; Εξηγείστε αναλυτικά την άποψή σας .
γ)  Με ποιον κλώνο του γονιδίου θα ενωθεί το μόριο ανιχνευτής ;
δ) Ποιο είναι το mRNA που θα προκύψει , από τη μεταγραφή του  επιθυμητού γονιδίου, στο βακτήριο ;
ε) Ποιο  είναι το  φαρμακευτικό πεπτίδιο που παράγει το βακτήριο αυτό ;

Δεν υπάρχουν σχόλια: