Τρίτη, 30 Αυγούστου 2016

ΑΣΚΣΗΣΗ ΜΕ ΕΚΦΡΑΣΗ ΑΣΥΝΕΧΟΥΣ ΓΟΝΙΔΙΟΥ ( ΠΟΙΟΤΙΚΗ)



Δίνεται το παρακάτω διακεκομμένο γονίδιο :
TTTTTGCTTAGGGCCCCCAAAAGTAGTGCATACATCGCGT
AAAAACGAATCCCGGGGGTTTT CATCACGTAT GTAGCGCA
Που κωδικοποιεί το πεπτίδιο :
H2N-met-tyr-phe-trp-gly-pro-COOH

 Να προσδιορίσετε :
α) Τον  προσανατολισμό των αλυσίδων του γονιδίου και να ορίσετε την κωδική αλυσίδα του
β) Το ώριμο και το πρόδρομο  mRNA , με τον προσανατολισμό τους
γ) Τα εσώνια του γονιδίου και του πρόδρομου mRNA
δ) Το πλήθος των μορίων νερού που απαιτούνται για την διαδικασία της ωρίμανσης που επιτελείται .
ε) Αν το λειτουργικό πεπτίδιο , για την υδρόλυσή του χρειάζεται την προσθήκη 3 μορίων νερού , να προσδιορίσετε την πιο πιθανή αλληλουχία των αμινοξέων του .
Αιτιολογείστε τις απαντήσεις σας .
Δίνεται ο γενετικός κώδικας .

Δεν υπάρχουν σχόλια: