Τρίτη, 30 Αυγούστου 2016

ΑΣΚΗΣΗ ΜΕ ΤΗ ΜΕΤΑΓΡΑΦΗ



Δίνεται ένα γονίδιο προκαρυωτικού κυττάρου σε σχέση με τις αλληλουχίες λήξης της μεταγραφής του:

CGAAACGTTTC CCGATCAATGTACAATTGACATGTAATTAACAC          αλυσίδα Α
GCTTTGCAAAG GGCTAGTTACATGTTAACTGTACATTAATT GTG          αλυσίδα Β

Οι αλληλουχίες λήξης της μεταγραφής του γονιδίου συμβολίζονται με κόκκινο χρώμα . Να προσδιοριστούν :
α)  η κωδική  και η μεταγραφόμενη αλυσίδα του γονιδίου , καθώς και ο προσανατολισμός τους ,
β)  το mRNA που προκύπτει από τη μεταγραφή του γονιδίου αυτού , με τον προσανατολισμό του ,
γ)  το πεπτίδιο που κωδικοποιεί το γονίδιο αυτό , με τον προσανατολισμό του ,
δ)  οι δεσμοί υδρογόνου του γονιδίου ,
ε)  να αιτιολογήσετε τις απαντήσεις σας .

Δεν υπάρχουν σχόλια: