Παρασκευή, 2 Σεπτεμβρίου 2016

ΑΣΚΗΣΗ ΜΕ ΜΕΤΑΓΡΑΦΗ




  ΑΛΥΣΊΔΑ  1 ........................................................................................
  ΑΛΥΣΙΔΑ  2 ........................................................................................ΟΗ-
      mRNA      AUUUAUGAAUCAGCUGAUUUACGUAUGAGCC

Το παραπάνω σχήμα απεικονίζει το υβρίδιο mRNADNA  που δημιουργείται κατά τη διαδικασία της μεταγραφής ενός βακτηριακού γονιδίου .Να βρεθούν :
α) οι προσανατολισμοί των αλυσίδων του DNA και του mRNA
β) Σε ποια θέση βρίσκεται ο υποκινητής του γονιδίου αυτού ;
γ) Πόσοι δεσμοί θα δημιουργηθούν και πόσοι θα διασπαστούν κατά τη δημιουργία της μεταγραφής αυτής ;
δ) Με τη χρήση του γενετικού κώδικα να βρεθεί το πεπτίδιο που θα παραχθεί και να σημειωθεί ο προσανατολισμός του .
ε) Όταν το tRNA που κουβάλησε το τρίτο αμινοξύ αποδεσμευτεί , ποιο θα είναι το αντικωδικόνιο του tRNA που θα προσέλθει ;

Δεν υπάρχουν σχόλια: