Τετάρτη, 16 Μαΐου 2012

ΑΣΚΗΣΗ ΜΕ ΩΡΙΜΑΝΣΗ















Σε ένα ανθρώπινο κύτταρο παράγεται το παρακάτω πενταπεπτίδιο :
H2N- Met-Gly-Pro-Tyr-Ala-COOH
Το ασυνεχές γονίδιο που είναι υπεύθυνο για το συγκεκριμένο ολιγοπεπτίδιο βρίσκεται ανάμεσα στις περιοχές Α και Β και η αλληλουχία των βάσεών του είναι  :

Α
ACCGATATGGGCTTGCTCTACCATATACGGACGCATAACATGCAG 3΄
Β
TGGCTATACCCGAACGAGATGGTATATGCCTGCGTATTGTACGTC

Να βρεθούν :
α) η κωδική αλυσίδα του γονιδίου
β) σε ποια από τις δύο περιοχές εκατέρωθεν του γονιδίου βρίσκεται ο Υποκινητής ; Η άλλη περιοχή πως ονομάζεται και ποιος ο ρόλος της ;
γ) να γράψετε το ώριμο mRNA ,με τον προσανατολισμό του
δ) να γράψετε το πρόδρομο mRNA , με τον προσανατολισμό του
ε) να απεικονίσετε τα δύο εσώνια του γονιδίου
στ) πόσοι φωσφοδιεστερικοί δεσμοί σπάνε και πόσοι δημιουργούνται κατά τη διαδικασία της  ωρίμανσης ;
Να λάβετε υπόψη ότι δεν έγινε μετα-μεταφραστική τροποποίηση.
 Δίνονται επίσης οι τριπλέτες που κωδικοποιούν τα αντίστοιχα αμινοξέα :
AUG-met , GGA-gly , CCA-pro , UAU- tyr , GCA- ala

1 σχόλιο:

PanReb είπε...

ΑΠΑΝΤΗΣΗ:

Α)Κωδική η 5΄ACC.....CAG 3'

Β)Στην Α περιοχή . Στην Β αντιστοιχούν οι αλληλουχίες λήξης της μεταγραφής , οι οποίες σταματούν την μεταγραφή και απελευθερώνουν το RNA .

Γ)
5ΑCCGAUAUGGGACCAUAUGCAUAACAUGCAAG3

Δ)Το ώριμο με τα εσώνια

Ε)5'...CTTGCTCT....ACGGAC...3'
3'...GAACGAGA....TGCCTG...5'

ΣΤ)Σπάνε 4 και δημιουργούνται 2.