Τρίτη, 26 Μαρτίου 2013

ΑΣΚΗΣΗ - ΑΝΑΣΥΝΔΙΑΣΜΕΝΟ DNA





















Στο παρακάτω τμήμα DNA  περιέχεται ένα ανθρώπινο γονίδιο:
ATCGAATTCΤΑΑGATGCTTAAGATAAATGTAACGTATATTGTATAACTTAAGAATTCCA
TAGCTTAAGATTCTACGAATTCTATT T ACATTGCATATAACATATTGAATTCTTAAGGT
Θέλουμε  με την βοήθεια της γενετικής  μηχανικής  να εισάγουμε το γονίδιο αυτό σε ένα βακτήριο .Για το σκοπό αυτό χρησιμοποιούμε την περιοριστική ενδουνοκλεάση EcoRI .
Να απαντήσετε στα παρακάτω ερωτήματα :
α) Πόσους δεσμούς και ποιους θα σπάσει η EcoRI στο τμήμα αυτό ;
β) Ποιον φορέα κλωνοποίησης θα χρησιμοποιήσουμε και γιατί ;
γ) Πόσοι δεσμοί και ποιοι θα σχηματιστούν για την δημιουργία του ανασυνδιασμένου DNA ;
δ) Πόσους δεσμούς και ποιους θα συνθέσει η DNA δεσμάση   
για τη δημιουργία του ανασυνδιασμένου DNA;
ε) Ποιο είναι το τμήμα του mRNA που μεταφράζεται από τα ριβοσώματα ;
στ) Ποιο είναι το ολιγοπεπτίδιο που παράγεται ;
Δίνεται ο γενετικός κώδικας .

1 σχόλιο:

PanReb είπε...

ΑΠΑΝΤΗΣΕΙΣ
Α) 4 Φ.Δ. και 16 Δ.Υ.
Β) 4 Φ.Δ. και 16 Δ.Υ.
Γ) 4 Φ.Δ.
Δ) 5΄...AUG-UUA-UAU-GCA-AUG-UAA...3'
E) H2N-met-leu-tyr-ala-met-COOH