Δευτέρα, 2 Ιανουαρίου 2012

ΔΙΑΓΩΝΙΣΜΑ ΣΤΗ ΒΙΟΛΟΓΙΑ Γ΄ΛΥΚΕΙΟΥ (ΚΑΤΕΥΘΥΝΣΗΣ)

ΒΙΟΛΟΓΙΑ Γ΄ΛΥΚΕΙΟΥ

ΚΑΤΕΥΘΥΝΣΗΣ

ΘΕΜΑ 1ο

Α. Στις προτάσεις 1 έως 5, να γράψετε στο τετράδιό σας τον αριθμό της βασικής πρότασης και δίπλα του το γράμμα που αντιστοιχεί στο σωστό συμπλήρωμά της.

1. Το χλωροπλαστικό γενετικό υλικό είναι :

α. γραμμικό δίκλωνο DNA μεγαλύτερου μήκους από το μιτοχονδριακό ,

β. κυκλικό δίκλωνο DNA μικρότερου μήκους από το μιτοχονδριακό ,

γ. κυκλικό δίκλωνο DNA μεγαλύτερου μήκους από το πυρηνικό DNA ,

δ. κυκλικό δίκλωνο DNA μεγαλύτερου μήκους από το μιτοχονδριακό DNA.

2. Ο χειριστής του οπερονίου της Λακτόζης :

α. είναι υπεύθυνος για τη σύνθεση του καταστολέα ,

β. είναι τμήμα DNA ,

γ. σ’ αυτόν προσδένεται η RNA πολυμεράση ,

δ. τίποτε από τα παραπάνω .

3. Η cDNA βιβλιοθήκη περιέχει :

α. τα εξώνια ,

β. τα εσώνια ,

γ. τον υποκινητή ,

δ. τα α και γ .

4. Το gene pharming αφορά :

α. την εκτροφή και διασταύρωση ζώων με σκοπό τη δημιουργία νέων ποικιλιών

β. την καλλιέργεια βακτηρίων για την παραγωγή φαρμακευτικών πρωτεϊνών ,

γ. την παραγωγή ανθρώπινης πρωτεΐνης από διαγονιδιακά ζώα ,

δ. τα β και γ .

5. Η 5΄και 3΄αμετάφραστες περιοχές του mRNA :

α. αντιστοιχούν στα εξώνια,

β. αντιστοιχούν στα εσώνια,

γ. αντιστοιχούν στα εξώνια και στα εσώνια,

δ. τίποτε από τα παραπάνω .

ΘΕΜΑ 2ο

Α. Σε τι θα συμβάλλει η ανάλυση του ανθρώπινου γονιδιώματος ;

Β. Δώστε τους ορισμούς :α) γονιδιακή θεραπεία ;

Γ. Ποια γονίδια καλούνται συνεπικρατή ; Δώστε παραδείγματα συνεπικρατών γονιδίων στον άνθρωπο ;

ΘΕΜΑ 3ο

Ένας άνδρας πάσχει από σύνδρομο και από αιμορροφιλία Α , ενώ και οι δύο γονείς του ήταν φυσιολογικοί .

Α) Τι γνωρίζεται για το σύνδρομο Klinefelter. Πώς μπορεί να προέκυψε ο άνδρας αυτός ;Απαντήστε στηριζόμενοι στον μηχανισμό της μείωσης .

Β) Αν ο μηχανισμός της μείωσης γινόταν φυσιολογικά ,τι πιθανότητες είχαν οι γονείς του άνδρα αυτού , να αποκτήσουν παιδί που πάσχει από αιμορροφιλία ;

Γ) Τι πιθανότητες έχει ο άνδρας αυτός ,αν διασταυρωθεί με φυσιολογική ομόζυγη γυναίκα να αποκτήσει παιδί φυσιολογικό ;

Δ) Ποιο άλλο είδος αιμορροφιλίας γνωρίζετε ; Με ποιες βιοτεχνολογικές μεθόδους μπορεί να αντιμετωπιστεί η ασθένεια αυτή;

ΘΕΜΑ 4ο

Δίνεται τμήμα DNA ευκαρυωτικού κυττάρου με την κάτωθι αλληλουχία ;

3΄GAATTCCTTAAGCTACATGTGGGGACCCTGAACCCCGGGAATTGAATTCCTTAAG 5

5’CTTAAGGAATTCGATGTACACCCCTGGGACTTGGGGCCCTTAACTTAAGGAATTC 3

Το τμήμα αυτό κωδικοποιεί το τετραπεπτίδιο : Η2Ν-met-trp-gly-pro-COOH

και κόβεται με την EcoRI προκειμένου να απομονωθεί το γονίδιο .

α) Να γράψετε το mRNA που κωδικοποιείται από το παραπάνω γονίδιο και σχηματίζει σύμπλοκο με τα ριβοσώματα του ευκαρυωτικού κυττάρου .Να δικαιολογήσετε την απάντησή σας .

β) Να γράψετε τις αλληλουχίες του ανασυνδιασμένου γονιδίου που θα δημιουργηθεί .

γ) Ποια βιβλιοθήκη κατασκευάζεται με αυτόν τον τρόπο ; Αιτιολογείστε την απάντησή σας .

δ) Μπορούν τα βακτήρια να παρασκευάσουν την ίδια πρωτεΐνη με αυτήν του ανθρώπινου κυττάρου; Αιτιολογείστε την απάντησή σας .

Δεν υπάρχουν σχόλια: